ID: 1135134004_1135134014

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1135134004 1135134014
Species Human (GRCh38) Human (GRCh38)
Location 16:19874451-19874473 16:19874480-19874502
Sequence CCTTCCTCCTGTCCTCCCATCCT CTCCATTGCAAGACGTGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 74, 3: 887, 4: 7983} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!