ID: 1135143168_1135143169

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1135143168 1135143169
Species Human (GRCh38) Human (GRCh38)
Location 16:19938985-19939007 16:19939008-19939030
Sequence CCAAATGCAATTTCTCAGCTTCA TCTCTGAATTAATAAAACTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 31, 4: 288} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!