ID: 1135204476_1135204478

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1135204476 1135204478
Species Human (GRCh38) Human (GRCh38)
Location 16:20471378-20471400 16:20471397-20471419
Sequence CCTTCCTACTTATACATAGACAT ACATATGCCTATAAACCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 158} {0: 2, 1: 0, 2: 0, 3: 7, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!