ID: 1135205513_1135205518

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1135205513 1135205518
Species Human (GRCh38) Human (GRCh38)
Location 16:20480620-20480642 16:20480648-20480670
Sequence CCTTGGAGACCGGGGAATCAAAG GATGGGTATTTCCAGTTTATGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 99} {0: 2, 1: 0, 2: 1, 3: 14, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!