ID: 1135245714_1135245716

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1135245714 1135245716
Species Human (GRCh38) Human (GRCh38)
Location 16:20855280-20855302 16:20855307-20855329
Sequence CCTAGTCATATTCATTAGTGCAA TAAGAGCAATTAAGCACAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 162} {0: 1, 1: 0, 2: 2, 3: 12, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!