ID: 1135276983_1135276986

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1135276983 1135276986
Species Human (GRCh38) Human (GRCh38)
Location 16:21121693-21121715 16:21121734-21121756
Sequence CCGGGTTCAAGTGATTCTCCTAC CTTGTTAGAAGCACAATTCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 21, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!