ID: 1135288093_1135288096

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1135288093 1135288096
Species Human (GRCh38) Human (GRCh38)
Location 16:21211306-21211328 16:21211343-21211365
Sequence CCTGGAAAGGCAGGATTTACCAA TGGAGTTCCCTGAAGTCACAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 19, 4: 224} {0: 1, 1: 0, 2: 1, 3: 20, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!