ID: 1135298002_1135298011

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1135298002 1135298011
Species Human (GRCh38) Human (GRCh38)
Location 16:21300247-21300269 16:21300270-21300292
Sequence CCTTTTGTCCTCCAACATACACT TGATAGGAGTGGGGGAGTGGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 32, 4: 240} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!