ID: 1135329037_1135329041

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1135329037 1135329041
Species Human (GRCh38) Human (GRCh38)
Location 16:21545887-21545909 16:21545906-21545928
Sequence CCCAGCTCCATCTGGACCAGCCC GCCCGCACCATTGTTAACACAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 1, 3: 4, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!