ID: 1135337222_1135337231

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1135337222 1135337231
Species Human (GRCh38) Human (GRCh38)
Location 16:21613265-21613287 16:21613305-21613327
Sequence CCTCCGCCTCCCGGGTTTAAGTA TCCCAAGTAGCTGGGATTACAGG
Strand - +
Off-target summary {0: 2, 1: 409, 2: 12721, 3: 70978, 4: 158488} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!