ID: 1135350064_1135350068

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1135350064 1135350068
Species Human (GRCh38) Human (GRCh38)
Location 16:21721375-21721397 16:21721411-21721433
Sequence CCATGTCTGCAAACATTTTTGGT GCAGAGCTACTGGCCTCTAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 12, 3: 81, 4: 464}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!