ID: 1135350064_1135350073

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1135350064 1135350073
Species Human (GRCh38) Human (GRCh38)
Location 16:21721375-21721397 16:21721424-21721446
Sequence CCATGTCTGCAAACATTTTTGGT CCTCTAGTGGGTAGAGGCCAGGG
Strand - +
Off-target summary No data {0: 7, 1: 193, 2: 686, 3: 1140, 4: 1521}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!