ID: 1135375653_1135375660

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1135375653 1135375660
Species Human (GRCh38) Human (GRCh38)
Location 16:21944744-21944766 16:21944760-21944782
Sequence CCTTTTGTCCTCCAACATACACT ATACACTTGATAGGAATTGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 3, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!