ID: 1135386285_1135386288

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1135386285 1135386288
Species Human (GRCh38) Human (GRCh38)
Location 16:22043875-22043897 16:22043914-22043936
Sequence CCAAGACTGGGTAATTTATAAAG GACTCACAGTTCCACGTGACTGG
Strand - +
Off-target summary {0: 3429, 1: 4465, 2: 3325, 3: 3035, 4: 2495} {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!