ID: 1135409888_1135409891

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1135409888 1135409891
Species Human (GRCh38) Human (GRCh38)
Location 16:22225656-22225678 16:22225674-22225696
Sequence CCTTCGCCTCTGCATTTGTCCAG TCCAGTAACTCTGGCTGTGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 177} {0: 1, 1: 0, 2: 0, 3: 8, 4: 146}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
-5 16:22225656-22225678 CCTTCGCCTCTGCATTTGTCCAG - 16:22225674-22225696 TCCAGTAACTCTGGCTGTGCCGG +