ID: 1135421634_1135421641

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1135421634 1135421641
Species Human (GRCh38) Human (GRCh38)
Location 16:22309065-22309087 16:22309115-22309137
Sequence CCGGTTTCCCTGCGTTCACACAG GACCCCCTTTGCCCCGTCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 192} {0: 1, 1: 0, 2: 0, 3: 12, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!