|
Left Crispr |
Right Crispr |
| Crispr ID |
1135447911 |
1135447915 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:22534546-22534568
|
16:22534575-22534597
|
| Sequence |
CCTTCCACCCTCAGCAGATGATA |
AGACACCTGCCGAGCGTCTGCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 54, 2: 11, 3: 22, 4: 186} |
{0: 70, 1: 8, 2: 7, 3: 7, 4: 80} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|