|
Left Crispr |
Right Crispr |
| Crispr ID |
1135447911 |
1135447916 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:22534546-22534568
|
16:22534576-22534598
|
| Sequence |
CCTTCCACCCTCAGCAGATGATA |
GACACCTGCCGAGCGTCTGCGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 54, 2: 11, 3: 22, 4: 186} |
{0: 69, 1: 8, 2: 1, 3: 4, 4: 79} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|