ID: 1135447911_1135447918

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1135447911 1135447918
Species Human (GRCh38) Human (GRCh38)
Location 16:22534546-22534568 16:22534578-22534600
Sequence CCTTCCACCCTCAGCAGATGATA CACCTGCCGAGCGTCTGCGGGGG
Strand - +
Off-target summary {0: 2, 1: 54, 2: 11, 3: 22, 4: 186} {0: 65, 1: 7, 2: 1, 3: 3, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!