ID: 1135459908_1135459916

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1135459908 1135459916
Species Human (GRCh38) Human (GRCh38)
Location 16:22633214-22633236 16:22633262-22633284
Sequence CCTCCCTGTAGCTGGGCCTACAG TTTTTATGTTTTGTAGAGATGGG
Strand - +
Off-target summary No data {0: 51, 1: 1561, 2: 15057, 3: 134247, 4: 299474}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!