|
Left Crispr |
Right Crispr |
| Crispr ID |
1135459908 |
1135459916 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:22633214-22633236
|
16:22633262-22633284
|
| Sequence |
CCTCCCTGTAGCTGGGCCTACAG |
TTTTTATGTTTTGTAGAGATGGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 51, 1: 1561, 2: 15057, 3: 134247, 4: 299474} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|