ID: 1135459910_1135459915

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1135459910 1135459915
Species Human (GRCh38) Human (GRCh38)
Location 16:22633217-22633239 16:22633261-22633283
Sequence CCCTGTAGCTGGGCCTACAGGCA TTTTTTATGTTTTGTAGAGATGG
Strand - +
Off-target summary No data {0: 47, 1: 1473, 2: 18829, 3: 246199, 4: 258253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!