ID: 1135459910_1135459917

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1135459910 1135459917
Species Human (GRCh38) Human (GRCh38)
Location 16:22633217-22633239 16:22633263-22633285
Sequence CCCTGTAGCTGGGCCTACAGGCA TTTTATGTTTTGTAGAGATGGGG
Strand - +
Off-target summary {0: 4, 1: 632, 2: 36045, 3: 138961, 4: 149088} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!