ID: 1135459911_1135459915

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1135459911 1135459915
Species Human (GRCh38) Human (GRCh38)
Location 16:22633218-22633240 16:22633261-22633283
Sequence CCTGTAGCTGGGCCTACAGGCAC TTTTTTATGTTTTGTAGAGATGG
Strand - +
Off-target summary {0: 9, 1: 1091, 2: 4833, 3: 7693, 4: 7648} {0: 47, 1: 1473, 2: 18829, 3: 246199, 4: 258253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!