ID: 1135464883_1135464889

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1135464883 1135464889
Species Human (GRCh38) Human (GRCh38)
Location 16:22676688-22676710 16:22676719-22676741
Sequence CCGACTGAGAACCACTGAATTAG GGCAGGGATCCTATCGAAAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 22, 3: 128, 4: 538} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!