ID: 1135512631_1135512637

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1135512631 1135512637
Species Human (GRCh38) Human (GRCh38)
Location 16:23100434-23100456 16:23100475-23100497
Sequence CCATTTATATAGAAGTCTAGACT ACAAAGCAGAATAGTGGGCCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 35, 4: 325}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!