ID: 1135524180_1135524187

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1135524180 1135524187
Species Human (GRCh38) Human (GRCh38)
Location 16:23201268-23201290 16:23201308-23201330
Sequence CCCTCTTCCCCCTTTTCAAACTG TTGTAAAAGTATAAGAACTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 52, 4: 471} {0: 1, 1: 0, 2: 1, 3: 25, 4: 324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!