ID: 1135546792_1135546809

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1135546792 1135546809
Species Human (GRCh38) Human (GRCh38)
Location 16:23371909-23371931 16:23371959-23371981
Sequence CCCCGGGGCCCCTGTCCGGGTTT AGAGCTGGCCCCAGCAAGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 87} {0: 1, 1: 0, 2: 0, 3: 20, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!