ID: 1135554503_1135554516

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1135554503 1135554516
Species Human (GRCh38) Human (GRCh38)
Location 16:23424812-23424834 16:23424853-23424875
Sequence CCAGCAGCCTGGTGAGCTCCTGC ACGCCGTTGCTGAGGCAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 32, 4: 364} {0: 1, 1: 0, 2: 0, 3: 15, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!