ID: 1135554506_1135554521

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1135554506 1135554521
Species Human (GRCh38) Human (GRCh38)
Location 16:23424819-23424841 16:23424870-23424892
Sequence CCTGGTGAGCTCCTGCTCGGGCC GGAGGGCAGCGAGGGCATGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 170} {0: 1, 1: 0, 2: 5, 3: 63, 4: 611}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!