ID: 1135606557_1135606563

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1135606557 1135606563
Species Human (GRCh38) Human (GRCh38)
Location 16:23831057-23831079 16:23831109-23831131
Sequence CCATTGTCTAGTAGGCTCACCTT GTTTATTTTTTCCCTTTGAAGGG
Strand - +
Off-target summary No data {0: 2, 1: 4, 2: 24, 3: 105, 4: 922}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!