ID: 1135607353_1135607370

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1135607353 1135607370
Species Human (GRCh38) Human (GRCh38)
Location 16:23836096-23836118 16:23836131-23836153
Sequence CCGCGCCTCCCCGGCCCGCAGCC GCCCCGGGGCCGGCACCTCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 151, 4: 1041} {0: 1, 1: 0, 2: 1, 3: 20, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!