ID: 1135607371_1135607379

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1135607371 1135607379
Species Human (GRCh38) Human (GRCh38)
Location 16:23836132-23836154 16:23836157-23836179
Sequence CCCCGGGGCCGGCACCTCTCGGG CCGGCTCCCCGCGCGCAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 142} {0: 1, 1: 0, 2: 0, 3: 7, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!