ID: 1135607376_1135607379

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1135607376 1135607379
Species Human (GRCh38) Human (GRCh38)
Location 16:23836140-23836162 16:23836157-23836179
Sequence CCGGCACCTCTCGGGCTCCGGCT CCGGCTCCCCGCGCGCAAGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 375} {0: 1, 1: 0, 2: 0, 3: 7, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!