ID: 1135656574_1135656580

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1135656574 1135656580
Species Human (GRCh38) Human (GRCh38)
Location 16:24255809-24255831 16:24255834-24255856
Sequence CCGGGTCGTGCTGCAGCGCCCAG GCCAGGGCGCTGACTGTCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 162} {0: 1, 1: 0, 2: 1, 3: 17, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!