ID: 1135660965_1135660970

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1135660965 1135660970
Species Human (GRCh38) Human (GRCh38)
Location 16:24296206-24296228 16:24296221-24296243
Sequence CCACCCTCAGGGTGACTCCCACC CTCCCACCTAGGGATTTACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 497} {0: 1, 1: 0, 2: 0, 3: 9, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!