|
Left Crispr |
Right Crispr |
| Crispr ID |
1135667878 |
1135667884 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:24351281-24351303
|
16:24351313-24351335
|
| Sequence |
CCAGTTTCAGCCAGGCATGGTGG |
GTAACCCCAGCACTTTTGGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 5, 2: 71, 3: 270, 4: 1171} |
{0: 6, 1: 646, 2: 1361, 3: 4042, 4: 4256} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|