ID: 1135669338_1135669351

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1135669338 1135669351
Species Human (GRCh38) Human (GRCh38)
Location 16:24361834-24361856 16:24361885-24361907
Sequence CCGGCCAACAGGCGCACCACGCC CACGCCCAGCACAGCCTTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 78} {0: 1, 1: 0, 2: 2, 3: 29, 4: 333}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!