ID: 1135669343_1135669351

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1135669343 1135669351
Species Human (GRCh38) Human (GRCh38)
Location 16:24361869-24361891 16:24361885-24361907
Sequence CCTCTGACCTCTGCCCCACGCCC CACGCCCAGCACAGCCTTGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 79, 4: 748} {0: 1, 1: 0, 2: 2, 3: 29, 4: 333}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!