ID: 1135691258_1135691262

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1135691258 1135691262
Species Human (GRCh38) Human (GRCh38)
Location 16:24539695-24539717 16:24539713-24539735
Sequence CCGCTGCCCAGCAGCTTGCGGGC CGGGCGTGTTCTCGCGGTTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 286} {0: 1, 1: 0, 2: 0, 3: 1, 4: 20}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!