ID: 1135715287_1135715293

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1135715287 1135715293
Species Human (GRCh38) Human (GRCh38)
Location 16:24759581-24759603 16:24759616-24759638
Sequence CCTGGAGATAGAGGGAGCCACAG GTTAAGCCAGCAAAGGTGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 53, 4: 405} {0: 1, 1: 0, 2: 0, 3: 10, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!