ID: 1135717001_1135717002

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1135717001 1135717002
Species Human (GRCh38) Human (GRCh38)
Location 16:24779983-24780005 16:24779998-24780020
Sequence CCTCTTTTTTGCAGTTGACCACT TGACCACTTAGACCCCAAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 188} {0: 1, 1: 0, 2: 2, 3: 14, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!