ID: 1135720378_1135720380

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1135720378 1135720380
Species Human (GRCh38) Human (GRCh38)
Location 16:24812468-24812490 16:24812488-24812510
Sequence CCAGTCATGCACCACTTAATGGC GGCAATGTTTCAGTAAACAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 74} {0: 1, 1: 0, 2: 7, 3: 45, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!