ID: 1135729448_1135729455

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1135729448 1135729455
Species Human (GRCh38) Human (GRCh38)
Location 16:24882156-24882178 16:24882179-24882201
Sequence CCATTTTGTTGGCCTCTGCATCC CTACCACGTAGAACTTGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 230} {0: 1, 1: 0, 2: 0, 3: 4, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!