ID: 1135730522_1135730524

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1135730522 1135730524
Species Human (GRCh38) Human (GRCh38)
Location 16:24891240-24891262 16:24891266-24891288
Sequence CCTCTGTGAATGGGAATGACAAA AAAGCTGCTGATATTTGCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 243} {0: 1, 1: 0, 2: 2, 3: 15, 4: 285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!