ID: 1135747768_1135747775

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1135747768 1135747775
Species Human (GRCh38) Human (GRCh38)
Location 16:25031879-25031901 16:25031923-25031945
Sequence CCATGGCCACTAGACAGAGGGAG TCCACCTGGAATTGCGACGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 189} {0: 1, 1: 0, 2: 0, 3: 1, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!