ID: 1135757728_1135757731

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1135757728 1135757731
Species Human (GRCh38) Human (GRCh38)
Location 16:25111918-25111940 16:25111934-25111956
Sequence CCTGCTGTTCCACCTCGAGCTGC GAGCTGCGACGCAGACGACGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 293} {0: 1, 1: 0, 2: 0, 3: 6, 4: 41}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!