ID: 1135762903_1135762908

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1135762903 1135762908
Species Human (GRCh38) Human (GRCh38)
Location 16:25151849-25151871 16:25151871-25151893
Sequence CCTGCTAGAAGTCAACAACAGAC CACTTTGAAGGAGGGGCAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 123} {0: 2, 1: 5, 2: 20, 3: 52, 4: 319}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!