ID: 1135765887_1135765897

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1135765887 1135765897
Species Human (GRCh38) Human (GRCh38)
Location 16:25177811-25177833 16:25177857-25177879
Sequence CCACCCATAAACACAGTCTTACC CCTCATTTTATGTAGCAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 140} {0: 1, 1: 0, 2: 0, 3: 18, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!