ID: 1135826319_1135826325

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1135826319 1135826325
Species Human (GRCh38) Human (GRCh38)
Location 16:25731692-25731714 16:25731715-25731737
Sequence CCCAGGAGCTGGTCAAAAGTTGG TCCTTTCTTTGGAATGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 133} {0: 1, 1: 4, 2: 19, 3: 66, 4: 2149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!