ID: 1135848450_1135848455

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1135848450 1135848455
Species Human (GRCh38) Human (GRCh38)
Location 16:25940439-25940461 16:25940479-25940501
Sequence CCAAGATGTCAAGGCAAAGCATA AGGGATTTACAACATGAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 209} {0: 1, 1: 0, 2: 0, 3: 24, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!